1601
Research Title: PV Inverters Reliability Prediction
Author: Firas Abdullah Obeidat, Published Year: 2017
World Applied Sciences Journal, 35 (2)
Faculty: Engineering and Technology

Abstract: This paper initially discusses the reliability of a 250W Photovoltaic (PV) micro inverter. Using the bill of materials the reliabilities of the main, gate drive, power supply, current and voltage sensing and microprocessor circuits were investigated and the failure rate and Mean Time Between Failure (MTBF) calculated. The sum of component failure rates equals the complete PV micro inverter failure rate. To account for temperature effects the component failure rate was calculated for each inverter operating temperature and multiplied by the percentage occurrence of this operating temperature to obtain a weighted failure rate. A similar procedure was used to calculate the failure rate for the main circuits of a 4.6kW & a 4.5kW multi-string inverter. All calculations are based on MIL-217F N2 method.

Keywords: Failure rate, MIL-HDBK-217F N2, PV micro inverter, PV multi string inverter, Reliability prediction.

1602
Research Title: EMBEDDING MIXED-REALITY LABORATORIES INTO E-LEARNING SYSTEMS FOR ENGINEERING EDUCATION
Author: Kasim Mousa Al-Aubidy, Published Year: 2013
International Conference on E-Learning and Blended Education (ICELBE2013), , Jordan
Faculty: Engineering and Technology

Abstract: E-learning, virtual learning and mixed reality techniques are now a global integral part of the academic and educational systems. They provide easier access to educational opportunities to a very wide spectrum of individuals to pursue their educational and qualification objectives. These modern techniques have the potentials to improve the quality of the teaching and learning process and elevate its performance to higher standards. Furthermore, e-learning in conjunction with mixed reality techniques can reduce the cost of higher education at both institutional and individual learner levels. In this paper, the focus will be on teaching-learning of applied science such as engineering. These studies demand special requirements, such as acquiring specific technical skills and practices through training. In this paper is the explanation and design of remote laboratories in mixed-reality mode. Decision making and evaluation of performance using fuzzy logic will be embedded in the proposed design.

Keywords: E-learning, Engineering Education, Virtual Labs, Remote Labs, Mixed- Reality, Fuzzy Decision Making.

1603
Research Title: Seroprevalence of Brucella species among women with miscarriage in Jordan
Author: Marwan Abu-Halaweh, Published Year: 2011
M. Eastern Mediterranean Health Journal, 17.11
Faculty: Science

Abstract: Results differ as to whether Brucella infection during pregnancy increases a woman’s risk of miscarriage. We determined the seroprevalence of Brucella spp. among a sample of women with miscarriage and women with no history of miscarriage in Jordan during January–July 2003. Serum samples were collected from 445 women with miscarriage and a similar number of women with no history of miscarriage, matched on age, socioeconomic status and residence. Sera were tested using the Rose Bengal plate test and complement fixation test. The true seroprevalence among women with miscarriage was 1.8% (95% CI: 0.6–3.0), while the true seroprevalence among women with no history of miscarriage was 1.0% (95% CI: 0.08–1.9). There was no significant difference between seroprevalences of Brucella spp. among women with miscarriage and those with no history of miscarriage (P = 0.6).

Keywords: Brucella, miscarriage,

1604
Research Title: Flock-level seroprevalence of, and risk factors for, Neospora caninum among sheep and goats in northern Jordan
Author: Marwan Abu-Halaweh, Published Year: 2010
Preventive Veterinary Medicine , 93, Issue 1
Faculty: Science

Abstract: During the period January 2002 to December 2003, serum samples were collected from 104 small ruminant flocks consisting of 18 sheep flocks, 27 goat flocks and 59 mixed flocks containing both sheep and goats in northern Jordan. Only female animals were sampled. At least 5 females aged over 2 years per flock per species were sampled and examined for anti-Neospora caninum antibodies using ELISA. To increase the chances of detecting positive flocks, sick or older ewes were sampled. Also, N. caninum DNA was investigated in 7 sheep brains using PCR technique and 1 was found positive. The flock-level true seroprevalence in small ruminants was 53% (95% CI: 43,63). The true flock-level seroprevalence was higher in sheep (92%) than goats (12%) (OR = 55; 95% CI: 17,197). Similarly, the individual-level seroprevalence in sheep and goat was 63% and 2% respectively (OR = 25; 95% CI: 16,39). Out of 32 production and health management variables, the presence of dogs with the flock (OR = 3.6, 95% CI: 1.2,10) enhanced seropositivity. Cold temperate climate (OR = 0.1, 95% CI: 0.03,0.4), veterinary supervision (OR = 0.2, 95% CI: 0.06,0.6) and buying healthy animals to replace those culled (OR = 0.3, 95% CI: 0.1,0.97) reduced the risk of seropositivity. Both sheep and goats in Jordan are exposed to N. caninum infection with higher seroprevalence in sheep than goats. The contribution of N. caninum to abortion in small ruminant flock needs to be evaluated. Educating the farmers with regard to the role of dogs in transmitting N. caninum infection is expected to enhance small ruminant health in Jordan.

Keywords: Neospora caninum; Small ruminants; Sheep; Goat; PCR; Seroprevalence; Risk factors; Jordan

1605
Research Title: Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR
Author: Marwan Abu-Halaweh, Published Year: 2005
Research in Microbiology, 156
Faculty: Science

Abstract: A two-tube real-time assay, developed in a LightCyclerTM, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5′-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3′) and a universal downstream probe Cy5 (5′-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO4-3′), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024–1048 and 1050–1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 °C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85±0.5 and 56 °C determined from temperature-dependent dye–DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli–C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.

Keywords: Campylobacter; Thermotolerance; hipO gene; 16S rRNA; Real-time PCR; Fluorescent adjacent probes; SYBR Green I

1606
Research Title: Embedding Mixed-Reality Laboratories into E-Learning Systems for Engineering Education
Author: Kasim Mousa Al-Aubidy, Published Year: 2013
International Conference on E-Learning and Blended Education (ICELBE2013), Jordan
Faculty: Engineering and Technology

Abstract: E-learning, virtual learning and mixed reality techniques are now a global integral part of the academic and educational systems. They provide easier access to educational opportunities to a very wide spectrum of individuals to pursue their educational and qualification objectives. These modern techniques have the potentials to improve the quality of the teaching and learning process and elevate its performance to higher standards. Furthermore, e-learning in conjunction with mixed reality techniques can reduce the cost of higher education at both institutional and individual learner levels. In this paper, the focus will be on teaching-learning of applied science such as engineering. These studies demand special requirements, such as acquiring specific technical skills and practices through training. Our objective in this paper is the explanation and design of remote laboratories in mixed-reality mode. Decision making and evaluation of performance using fuzzy logic will be embedded in the proposed design.

Keywords: e-learning, engineering education, virtual labs, remote labs, mixed- reality, fuzzy decision making.

1607
Research Title: Fundamental Issues in the Stability of Adaptive IIR Filters
Author: Mohammad Abdul Qader Abu Naser, Published Year: 2009
Digital Signal Processing Workshop, USA
Faculty: Engineering and Technology

Abstract: Adaptive IIR filter analysis is more complicated than for the FIR case because (a) some algorithm signals are generated by the adaptive filter itself, and (b) the prediction error relates to the adapted parameters via a filtering operation. Averaging analyses of stability address the first issue by linearization about the convergence point, and the second by using passivity of the error operator. However, published results do not fully account for signal dynamics in the linearization, nor have initial conditions in the passivity analysis been considered. This paper addresses these gaps. Our motivation to revisit these broadly applicable issues is for analyzing recently developed adaptive algorithms that have application to biological systems.

Keywords: IIR filters, Algorithm design and analysis, Stability analysis

1608
Research Title: Convergence of Adaptive Estimators of Time-Varying Linear Systems using Basis Functions: Continuous Time Results
Author: Mohammad Abdul Qader Abu Naser, Published Year: 2007
International Conference on Acoustics, Speech, and Signal Processing, USA
Faculty: Engineering and Technology

Abstract: The convergence properties of adaptive filtering algorithms are investigated in situations where the optimal filter is modeled as a time-varying linear system whose parameters are expanded over basis functions. This type of model is one approach when parameters cannot be considered as slowly varying, and is appropriate for modeling certain mobile radio channels and in the identification of the dynamics of vascular autoregulation in kidneys. Appropriate adaptive algorithms are developed in a continuous-time setting, and the local convergence of these algorithms is studied. Conditions for convergence are shown to include an excitation condition on the algorithm regressor and a passivity condition on an algorithm operator. The excitation conditions are interpreted in terms of system signals and the parameter basis functions using previously established results in the discrete-time case. A test for the passivity condition is developed whose application is presented via an illustrative example.

Keywords: Adaptive algorithm, Parameter estimation, Convergence

1609
Research Title: Convergence properties of adaptive estimators of time-varying linear systems using basis functions
Author: Mohammad Abdul Qader Abu Naser, Published Year: 2006
Digital Signal Processing Workshop, USA
Faculty: Engineering and Technology

Abstract: The estimation of time-varying linear systems using a basis function approach has been applied in various fields such as equalization of mobile radio channels and in estimation of dynamics in biological systems. Typically, time-varying finite impulse response system models have been employed with recursive least squares or least mean squares adaptation. In this paper the convergence properties of these and other adaptive algorithms employed in this setting are formulated. The use of time-varying ARMA models is also included in the framework that is examined. The relation of the prediction error with the parameter error and the system regressor is exposed, indicating that a previously analyzed class of adaptive algorithms is appropriate for these problems. The convergence of this class of algorithms is dependent on a persistent excitation condition on system signals and a passivity condition on a system operator. Requirements for system regressors to be persistently exciting are derived for the time-varying linear system identification using basis functions, and the relevant operator conditions are described.

Keywords: Adaptive algorithm, Parameter estimation, Convergence

1610
Research Title: Vascular resistance estimation in renal hemodynamics using a time-varying windkessel model
Author: Mohammad Abdul Qader Abu Naser, Published Year: 2005
International Conference on Acoustics, Speech, and Signal Processing, USA
Faculty: Engineering and Technology

Abstract: In studies of the dynamics of renal vascular response to blood pressure variations, measurements of pressure and flow rate are typically utilized to characterize a dynamic response with pressure as input and flow as output. However, the primary regulatory effect is the adjustment of vascular resistance, so that a record of a resistance time series would better serve as the regulated output. Toward this goal, a technique is developed for estimating the parameters of a three-element, time-varying Windkessel model of the renal vasculature that enables resistance estimation. The method is described, analyzed, and applied to renal pressure/flow data from rats.

Keywords: Vascular resistance measurement, Hemodynamics, renal vasculature