| 1491 |
Research Title: التطور التاريخي لمفهوم وسط أوروبا وتأثير الحرب الأولى1914-1919م
Author: Amjad Ahmad Alzoubi, Published Year: 2016
المؤتمر السنوي الثاني للدراسات التاريخية :مائة عام على الحرب الأولى , بيروت
Faculty: Arts
Abstract: ملخص:
يرتبط المصطلح الجيوسياسي بدرجة كبيرة جدا بإطار مدلوله التاريخي وفقا لما كان يعنيه في مرحلته وسياقه العام؛ فالمفهوم يكمن في أنه الوعاء الذي تطرح من خلاله الأفكار وتحدد من خلاله الرؤى، فالمفاهيم تقوم على شبكة متداخلة من المعطيات المادية والفكرية التي صاغت وحددت المفهوم. شكّل قلب القارة الأوروبية أو وسطها أو مركزها محورا أساسيا في التحولات الكبرى على صعيد القارة الأوروبية، وتداخلت فيه القوى المتصارعة في الحرب العالمية الأولى التي سعت لتشكيله وفقا لمصالحها ورؤيتها. وتكمن أهمية هذه الدراسة في أنها تضع مصطلح وسط أوروبا في سياقه، وتحاول أن تبين حجم الجدل الذي بدأ واستعر خلال الحرب العالمية الأولى حول المفهوم ومدلوله؛ فالمفهوم هلامي غير محدد الملامح، وهذه الدراسة لا تحاول تعريف ما هو موجود أو متخيل، وإنما ترمي إلى تتبع التطور التاريخي للمفهوم خلال الحرب العالمية الأولى، وإزالة اللبس الذي يقع فيه الكثيرون من الباحثين العرب عند تناول تاريخ المنطقة، حيث تعج الكتب المترجمة والمؤلفة عن المنطقة بمفاهيم وسط أوروبا أو أوروبا الوسطى دون تحديد لهذا المفهوم وبخاصة أن وسط أوروبا هي المفتاح الأساسي لمعالجة الحرب العالمية الأولى ومعرفة ذات جدوى في فهم الآخر. تعالج الورقة البحثية بالإضافة إلى التطور التاريخي جغرافية المنطقة، ووجهات النظر حولها، وعلاقة المفهوم بالمصالح والمشاريع للقوى الكبرى، وبخاصة المفهوم الألماني (Mitteleurpa) ونقيضه الذي طرح بديلا عنه اتحاد وسط أوروبا الديمقراطي، و نهاية الحرب العالمية الأولى، ومؤتمر الصلح في فرساي 1919-1920م، استنادا للمصادر الأولية والكتابات السابقة.
يتألف البحث من ثلاث محاور رئيسة :
1. مقدمة جغرافية تاريخية (جيوتاريخية) في إشكالية المفهوم :بحثت في الجدل الذي قام ما بين الجغرافيين والمؤرخين حول المفهوم كل على حدا،حيث كان الانقسام واضح حول وجود هوية خاصة لوسط أوروبا لها حدودها وسماتها وخصائصها الثقافية والحضارية، وبين من قال بأن المفهوم لا وجود له أصلا ، وهو ضرب من الخيال ،يعبر عن العقلية التوسعية الألمانية .
2. مفهوم وسط أوروبا الألماني والحرب العالمية الأولى: يرتبط مفهوم وسط أوروبا بالمفهوم الألماني (Mitteleuropa) والسياسة الألمانية في بناء القوة داخل القارة الأوروبية؛ فقد كانت الإستراتيجية الألمانية خلال الحرب قائمة على تحقيق ذلك ،وتم التعبير عنها بما يعرف بخطة أيلول 1914م، التي أعدها المستشار الألماني بيتمان هولفيج. وهذه الإستراتيجية قادت الباحثين والمفكرين الألمان نحو تأكيد هوية وسط أوروبا كوحدة سياسية – اقتصادية من جانب والتبشير بالنظام الجديد في ظل السيطرة الألمانية من جانب آخر؛ وبدون شك فإنّ كتاب فريدريش ناومان(F. Naumann) وسط أوروبا 1915م، يعد المحور الأساسي النظري لمفهوم وسط أوروبا، والذي عدّ خارج ألمانيا تعبيرا عن السياسة الخارجية الألمانية، وتمت ترجمته وطبعه باللغتين الفرنسية والانجليزية على هذا الأساس.
3. وسط أوروبا خارج المفهوم الألماني: بحث هذا المحور في خطة الحلفاء بتبني المعارضة في وسط أوروبا، خدمة للمصالح والخطط العسكرية، مما أدى إلى ظهور مفهوم جديد لوسط أوروبا "الاتحاد الديمقراطي لوسط أوروبا " الذي كان نتاج جهود التشيكي ماساريكي الذي أصبح أول رئيس للدولة الاتحادية الجديدة "تشيكوسلوفاكيا" .وعرضنا لطبيعة النقاش الذي دار في جلسات الإعداد والتحضير والخلافات حتى فشل المشروع .وتمّ وإعادة رسم الخريطة الأوروبية دون أن يكون للمفهوم حضور، لينتهي النقاش حوله مرحليا، ويعاد على نفس الرتم في الحرب العالمية الثانية، ومرحلة الثمانينات، ونهاية الحرب الباردة، وبدايات النظام الدولي الجديد.
خلصت الدراسة إلى أن مفهوم وسط أوروبا هو مفهوم ألماني في أصله ،وأن تعميمه واستخدامه خارج الدوائر الألمانية هو مفهوم هلامي غامض ،وتلاشي المفهوم هو نتاج الحرب العالمية الأولى؛ فهزيمة ألمانيا قد عنت مرحليا إعادة ترسيم المنطقة برؤية ويل للمغلوب، وليس وفقا لمبدأ حق الشعوب في تقرير مصيرها، مما كان أساسا لإشعال الحرب العالمية الثانية .وهنا لابد من التأكيد على أن على الباحثين والكتاب عند استخدام المصطلح تحديد المنطقة التي يقصدونها بوسط أوروبا .
Keywords: الكلمات المفتاحية: وسط أوروبا، جغرافية، تاريخ، الهابسبورغ، فيدرالية، تقرير المصير.
|
| 1492 |
Research Title: بحث بعنوان:حركة الشباب الهيجلي 1827- 1848م
Author: Amjad Ahmad Alzoubi, Published Year: 2017
مؤتمر فيلادلفيا الدولي العشرون , عمان - الأردن
Faculty: Arts
Abstract: ملخص:
حركة الشباب الهيجلي حركة فلسفية – تاريخية تشكلت ما بين ثورتين 1830-1848م وهي نتاج طبيعي لطبيعة فيلسوفها الأول هيجل؛ فاحتكاك النص مع الواقع يولد اتجاهات مختلفة في كيفية فهم النص والتعامل معه في بعديه الزماني والمكاني، فتجد من يتمسك بالنص على أنه نص مقدس وقالب واحد يجب صناعة وتشذيب كافة الحالات بناء عليه وبالتالي المغالاة والتطرف والمحافظة. في حين يرى فريق آخر معتدل أنه نص قابل للحياة مع متغيرات الزمان والمكان ضمن رؤية تجديدية تبقى محكومة بالنص أولا وآخرا. في حين يرى فريق ثالث يساري راديكالي التغيير والتجديد والتطوير في النظرية ليصل بها حدودا تتجاوز النص وتبشر بنظرية جديدة ونص جديد.
المدرسة الهيجلية انقسمت في الاتجاهات الثلاثة: يمين ووسط ويسار. وهذا شيء طبيعي لمدرسة فكرية أثرت وتأثرت في الحياة السياسية والفكرية على الساحة الأوروبية بشكل عام والألمانية بشكل خاص. فالفلسفة الهيجلية في حد ذاتها متاهة كبرى والجميع قادر على الإفادة منها، فالتوجهات المحافظة الرسمية رأت فيها فلسفتها الأولى وبالتالي هي فلسفة الدولة. في حين حاول الاتجاه الوسطي الموازنة ما بين التغيير التدريجي والمؤامة بين الدين والسياسة والفلسفة. أما الاتجاه اليساري فهي حركة الشباب الهيجلي التي قالت بالفصل الكامل ما بين الدين والسياسة وهاجمت الفكر الديني والفكر الهيجلي المتعلق بالموازنة بينهما لتفتح آفاقا جديدة ومنطلقات لفكر فلسفي ثوري وبخاصة في الفلسفة المادية والاشتراكية والجدلية الديلكتية.
قامت الدراسة على وضع الإطار الذي قامت عليه الحركة في جانبيها الفلسفي والتاريخي، مستعرضة الإشكالات في الفكر الهيجلي مع الابتعاد عن الخوض في المتاهة الفلسفية لهيجل بما له علاقة مباشرة في ظهور الحركة ونشأتها الأولى وحتى نهايتها إن جاز لنا التعبير مع استعراض للمقولات الأساسية التي ساهمت في تطورها،وتقديم نماذج في مقولاتها الأساسية في اللاهوت والدولة من خلال أبرز مفكريها: ديفيد شترواس وبرونو وباور وفيورباخ وأخيرا كارل ماركس.
Keywords: الكلمات المفتاحية:المدرسة الهيجلية ، الشباب الهيجلي، الجدلية ،نقد الدين ،تاريخ ألمانيا.
|
| 1493 |
Research Title: الآخر في فكر الأمير عبد القادر الجزائري :دراسة في فتنة دمشق 1860.
Author: Amjad Ahmad Alzoubi, Published Year: 2016
مجلة البحوث والدراسات الإنسانية ، جامعة 20 أوت 1955- سكيكيدة – الجزائر. العدد: 12 جوان 2016. ترقيم دولي: 1112-8151 الإيداع القانوني: 1005-2007, 16 12 ـجوان 2016
Faculty: Arts
Abstract: ملخص :
تحاول هذه الدراسة تلمس الآخر في فكر الأمير عبد القادر الجزائري في سياقها التاريخي والمنهجي في ما يمثل الأمير من رمزية المقاومة وروح الأمة المتسامحة القادرة على الجمع ما بين المتضادات في نسيج جمعي جميل؛ كانت فتنة دمشق في سنة 1860م حادثة عابرة في حياة الأمة ولكن ما جعلها عابرة هي رؤية الأمير الاستشرافية بمقاربة قلّ نظيرها؛ مع فتنة ضربت المفهوم الجمعي ومفهوم التعايش بين ديانتين لازالتا تقدمان نماذج التسامح والمحبة والإخاء خارج التعصب والتميز .
Keywords: الآخر ،فتنة دمشق ،تاريخ الجزائر و دمشق، التسامح .
|
| 1494 |
Research Title: Diagnosability of Programmable Logic Controller
Author: Mohammed Bani Younis, Published Year: 2017
Faculty: Engineering and Technology
Abstract: The diagnosis problem of Programmable Logic Controllers used to control industrial processes is an important research track. This paper introduces the use of slicing methods on programmable logic controller’s code. The used method enables better navigation of the program variables. These variables are mainly the inputs/outputs field devices installed on the plant. The Instruction List programming language is chosen to determine the software feasibility and applicability of the slicing method. The sliced program is exploited for the debugging purposes. An evaluation about the methods and techniques used for the Diagnosability are also provided in the scope of this paper. A case study is provided to ease the understanding of the used slicing technique.
Keywords: PLC; Program Slicing; Debugging; Diagnosability
|
| 1495 |
Research Title: ELASTIC BENDING DEFORMATION OF THE DRILL STRINGS IN CHANNELS OF CURVE WELLS
Author: Nabil Musa Wanas, Published Year: 2017
Modern Mechanical Engineering, 7
Faculty: Engineering and Technology
Abstract: The problem about identification of elastic bending of a drill string in a curve wells based on the theory of flexible curved rods and the direct inverse problems of drill string bending in the channels of curvilinear bore-holes are stated. The problems are solved which determine the resistance forces and moments during performing ascending-descending operations in curvilinear bore-holes with trajectories of the second order curve shapes. The sensitivity of the resistance forces relative to geometric parameters of the bore-hole axial line trajectories is analyzed.
Keywords: Curvilinear drilling; elastic bending; curve well; circular friction; ; Resistance forces
|
| 1496 |
Research Title: PV Inverters Reliability Prediction
Author: Firas Abdullah Obeidat, Published Year: 2017
World Applied Sciences Journal, 35 (2)
Faculty: Engineering and Technology
Abstract: This paper initially discusses the reliability of a 250W Photovoltaic (PV) micro inverter. Using the bill of materials the reliabilities of the main, gate drive, power supply, current and voltage sensing and microprocessor circuits were investigated and the failure rate and Mean Time Between Failure (MTBF) calculated. The sum of component failure rates equals the complete PV micro inverter failure rate. To account for temperature effects the component failure rate was calculated for each inverter operating temperature and multiplied by the percentage occurrence of this operating temperature to obtain a weighted failure rate. A similar procedure was used to calculate the failure rate for the main circuits of a 4.6kW & a 4.5kW multi-string inverter. All calculations are based on MIL-217F N2 method.
Keywords: Failure rate, MIL-HDBK-217F N2, PV micro inverter, PV multi string inverter, Reliability prediction.
|
| 1497 |
Research Title: EMBEDDING MIXED-REALITY LABORATORIES INTO E-LEARNING SYSTEMS FOR ENGINEERING EDUCATION
Author: Kasim Mousa Al-Aubidy, Published Year: 2013
International Conference on E-Learning and Blended Education (ICELBE2013), , Jordan
Faculty: Engineering and Technology
Abstract: E-learning, virtual learning and mixed reality techniques are now a global integral part of the academic and
educational systems. They provide easier access to educational opportunities to a very wide spectrum of individuals to
pursue their educational and qualification objectives. These modern techniques have the potentials to improve the
quality of the teaching and learning process and elevate its performance to higher standards. Furthermore, e-learning
in conjunction with mixed reality techniques can reduce the cost of higher education at both institutional and individual
learner levels.
In this paper, the focus will be on teaching-learning of applied science such as engineering. These studies demand
special requirements, such as acquiring specific technical skills and practices through training. In this paper is the
explanation and design of remote laboratories in mixed-reality mode. Decision making and evaluation of performance
using fuzzy logic will be embedded in the proposed design.
Keywords: E-learning, Engineering Education, Virtual Labs, Remote Labs, Mixed- Reality, Fuzzy Decision Making.
|
| 1498 |
Research Title: Seroprevalence of Brucella species among women with miscarriage in Jordan
Author: Marwan Abu-Halaweh, Published Year: 2011
M. Eastern Mediterranean Health Journal, 17.11
Faculty: Science
Abstract: Results differ as to whether Brucella infection during pregnancy increases a woman’s risk of miscarriage. We determined the seroprevalence of Brucella spp. among a sample of women with miscarriage and women with no history of miscarriage in Jordan during January–July 2003. Serum samples were collected from 445 women with miscarriage and a similar number of women with no history of miscarriage, matched on age, socioeconomic status and residence. Sera were tested using the Rose Bengal plate test and complement fixation test. The true seroprevalence among women with miscarriage was 1.8% (95% CI: 0.6–3.0), while the true seroprevalence among women with no history of miscarriage was 1.0% (95% CI: 0.08–1.9). There was no significant difference between
seroprevalences of Brucella spp. among women with miscarriage and those with no history of miscarriage (P = 0.6).
Keywords: Brucella, miscarriage,
|
| 1499 |
Research Title: Flock-level seroprevalence of, and risk factors for, Neospora caninum among sheep and goats in northern Jordan
Author: Marwan Abu-Halaweh, Published Year: 2010
Preventive Veterinary Medicine , 93, Issue 1
Faculty: Science
Abstract: During the period January 2002 to December 2003, serum samples were collected from 104 small ruminant flocks consisting of 18 sheep flocks, 27 goat flocks and 59 mixed flocks containing both sheep and goats in northern Jordan. Only female animals were sampled. At least 5 females aged over 2 years per flock per species were sampled and examined for anti-Neospora caninum antibodies using ELISA. To increase the chances of detecting positive flocks, sick or older ewes were sampled. Also, N. caninum DNA was investigated in 7 sheep brains using PCR technique and 1 was found positive. The flock-level true seroprevalence in small ruminants was 53% (95% CI: 43,63). The true flock-level seroprevalence was higher in sheep (92%) than goats (12%) (OR = 55; 95% CI: 17,197). Similarly, the individual-level seroprevalence in sheep and goat was 63% and 2% respectively (OR = 25; 95% CI: 16,39). Out of 32 production and health management variables, the presence of dogs with the flock (OR = 3.6, 95% CI: 1.2,10) enhanced seropositivity. Cold temperate climate (OR = 0.1, 95% CI: 0.03,0.4), veterinary supervision (OR = 0.2, 95% CI: 0.06,0.6) and buying healthy animals to replace those culled (OR = 0.3, 95% CI: 0.1,0.97) reduced the risk of seropositivity. Both sheep and goats in Jordan are exposed to N. caninum infection with higher seroprevalence in sheep than goats. The contribution of N. caninum to abortion in small ruminant flock needs to be evaluated. Educating the farmers with regard to the role of dogs in transmitting N. caninum infection is expected to enhance small ruminant health in Jordan.
Keywords: Neospora caninum; Small ruminants; Sheep; Goat; PCR; Seroprevalence; Risk factors; Jordan
|
| 1500 |
Research Title: Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR
Author: Marwan Abu-Halaweh, Published Year: 2005
Research in Microbiology, 156
Faculty: Science
Abstract: A two-tube real-time assay, developed in a LightCyclerTM, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5′-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3′) and a universal downstream probe Cy5 (5′-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO4-3′), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024–1048 and 1050–1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 °C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85±0.5 and 56 °C determined from temperature-dependent dye–DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli–C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.
Keywords: Campylobacter; Thermotolerance; hipO gene; 16S rRNA; Real-time PCR; Fluorescent adjacent probes; SYBR Green I
|